Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13146F11
Clone ID IST13146F11
Vector VICTR74
Project tigm

Sequence tag IST13146F11HMF1
Sequence
ACTCCAGACATCTTGGAAGGCATCCCAACTCTATTATTTATCAACAAGGAAGCAAAAGGATTTTTAAGTAAACGTTGAGA
TACAAAAATATCCTTAAGGCATGTATTCAGTTAAAAGTGAAGCAAAGTGGCTGGCAAATGCCAGTAATCCCAGCACTGGA
GCCGCANAGGCAGGAGGATCACCTANAANAGCAGAGCAGCCTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42923129..42923334 200
NO GENE  


Sequence tag IST13146F11BBF1
Sequence
NAACCNNACTGGCCTTGANCTCANANATCTGTCGAGGTCNATCGACGGTATCNATTANTCCAATTTANANGAGCATTGAT
TGCTCTTCCGCAGGTCCCGAGTCCAAATTCCAGCAACCACATGGTGGCTCACAACCATCTATAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI36417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6040400..6252229 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024773 (Atg2a) NM_194348 ATG2 autophagy related 2 homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Atg2a-001]

 
Come back to gene ENSMUSG00000024773


For any suggestions or comments, please send an email to unitrap@crg.es