Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14649D7
Clone ID IST14649D7
Vector VICTR74
Project tigm

Sequence tag IST14649D7HMF1
Sequence
AAAATGCCAGAAAACAAGGAAGAAGGGACAGGCCCTGCAGGCAGCTTGCCGTGCTCATCTGGGCAAGCTATCTTAGTCGC
AGAATGTGGCCCAGATTATCCCGGTGAGAGGGATGTTTTGGGTCCCTAGAGCTTGGGTGTGAGAGTGGCCCTGCAGCAAA
GCTTGGAGCAGCCAAACACAGGAAGCAGCAGGGAGATGCAGCCAGACAATGGAATCCCGTGGGCTAGGGCATGCAGAAAG
GCCCTACAGAAAGGCCAGGAACTAAGCANANTGCACAACAAGGGATCACAGGAACCCGAGTTTGCANCCTGGAANAAAAC
TTANGAAACCNAGAAACAGATTCCTTTTCCTAATCCCATTCACTCATTTAGCTATCTGTGTGTCTGTGTATGTCTGTGTG
TGNGTGNGTGTGTGTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165684619..165685035 401
 
EST/CDNA Est Name
  DV066041.1 - CN678630.1 - CN458361.1 - CN670238.1 - BQ557916.1 - CF537480.1 - CN682831.1 - CD546981.1 - CD542561.1 - CB246134.1 - BB859998.1 - CD561836.1 - BY207768.1 - AA178103.1 - CJ121989.1 - BY201037.1 - CJ162878.1 - CJ177349.1 - BY070894.1 - BY070678


Sequence tag IST14649D7BBF1
Sequence
AAAATGCNNNAAAACAAGGAANAAGGGACAGGCCCTGCAGGCAGCTTGCCGTGCTCATCTGGGCAAGCTATCTTAGTCGC
ANAANGTGGCCCAGATTATCCCGGTGAGAGGGATGTTTTGGGTCCCTAGAGCTTGGGTGTGANANTGGCCCTGCANCAAA
GCTTGGAGCANCCNANCNCNGGAANCANCAGGGANATGCNNCCAGACAATGGAATCCCGTGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14649D7HMR1
Sequence
TTTTCCTTGTCCNCATTANGGCNACTTTTGGAGCCTGAACCCTTCTGTGCTTGTGGCGAGCATGGCCTGGCTCCCANCAG
CCCTTCTTCCTTCTTCGTCTGACCCTATGAATCAGTAGGCCCTCTCTTGCTGCCACCCCTCCCCCCTCTGTAGTTTACAA
GCCACAGGCCCCGGGGCCTANCTCTGGGGTGGGATGAATGTGTTTGGTATCAATCCCAGANCCTGTTTCAGAGCCNGCAA
TGTTTGGTGGGCACCAAAGGAAGGACCTANCTANGTNCCCATGCTGGAGGAN
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165684332..165684622 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es