Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15060E3
Clone ID IST15060E3
Vector VICTR80
Project tigm

Sequence tag IST15060E3BBF1
Sequence
AGTTCAAATCCCAGCAACCACATGGTGGCTCATAACCACCCGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34480423..34480476 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97314667..97314720 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8363408..8363461 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109805915..109805968 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55039711..55039764 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 104575543..104575596 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75396858..75396911 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 55308437..55308490 54
NO GENE  


Sequence tag IST15060E3HMF2
Sequence
TAGCTAAATGTGTGAGTCGGGCGTTGTGTAGTGGTGACCGTCTGTCTATGTTTATCCTGCTTATGGCTTGAGGGTGGAGT
CCACCTATGGGGAATACACGGTTGCAGGAGTGTGAGGCTATTGCTCACCGACTGGGGACCAGGAAGCAAGGATGGGAGAA
CTCAGTTGGTTTTTCCTTCTTCCCTTTTTATTCAGTTCCAAGTTCTATCCTAGGGGGGGCTGCCGTAGGTCTTCCTGGAA
AAGCCCTCACAGACATACCTAGAAGGTGTGCCTCGCTAATGCTCTGGGTACTTGTTTTAGGAGGTTGGACTTCTCAGGGC
ACGGAGCACCATGGACCGGTTTCAATCCAGAAAGAGTTTGGAATCTCCCTGGGGATGCTGTGTGAAAGTGTTGAGTGAAA
GTGTTGAAGCAGANAGGACAAAGTTGGACCNAACCAGGGGTCTTGAGTGGGGAGGGGCAGTGTAACCTCNAGCTTTTACA
CACGTGCCCCTATTCCCANAATNATGAN
Sequence Type genomic DNA
Unitrap ID UNI11232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28096625..28097131 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es