Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST439081
Clone ID OST439081
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST439081
Sequence
TCATCCTACATGAGAGGCGGGTNTTTCTCCAGCAGCCATGAAGGATTCCCGTATGAGAAGGACCCCANGCTGTACTTTGA
TGATACTTGCGTGGNACCCNANAGACTGGAAGGCAAAGTCAAGCAGGAGCCCACCATGTATCGAGAGGGGCCTCCTTATC
AGAGACGAGGCTNTCTGCAGCTGNGGCAGNTNCTTGTCACCCTCCTGGATGACCCANCCAATGCCCACTTCATCGCCTGG
ACTGGCCGAGGCATGGAATTTAAGCTCATAGAACCGGAAGAGGNTGCTCGCCGNTGGGGTATCCAGAAGAATCGGNCAGC
CATGAACTATGACAAGCTGNGCCGCTCTCTCCGCTATTACTATGAAAAGGGCATCATGCAGAAGGTGGCTGGAGGAACGC
TACGTCTACAAATTTGTGTGTGACCCGGATGCACTCTTCTCTATGGNCTTCCCGGACAATCAGCGCCCGTTCCTGAAGGC
AGAATCCGAGG
Sequence Type mRNA
Unitrap ID UNI9709

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22383661..22399435 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es