Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13973D3
Clone ID IST13973D3
Vector VICTR74
Project tigm

Sequence tag IST13973D3BBF1
Sequence
CCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCN
Sequence Type genomic DNA
Unitrap ID UNI20989 UNI29541 UNI34526 UNI36419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63070622..63070670 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 49297613..49297661 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59173071..59173119 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3950547..3950595 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49737214..49737262 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35499489..35499537 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 27495066..27495114 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022265 (Ank) NM_020332 progressive ankylosis Gene [Source:MGI (curated);Acc:Ank-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 92053276..92053324 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32392559..32392607 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24368991..24369039 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066708 (AC134856.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5777218..5777266 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28488963..28489011 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68255107..68255155 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12320732..12320780 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53897808..53897856 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72706468..72706516 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28250341..28250389 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040466 (Blvrb) NM_144923 biliverdin reductase B (flavin reductase (NADPH)) Gene [Source:MGI (curated);Acc:Blvrb-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3490519..3490567 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 61298064..61298112 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11898207..11898255 49
NO GENE  


Sequence tag IST13973D3HMF2
Sequence
CCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCAGTAATGAGATCTGACTCTCTCTTCTGG
AGTGTCGGAAGACAGCTACAGTGTACTTACATATAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 125067574..125067705 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025551 (Fgf14) NM_010201 fibroblast growth factor 14 Gene [Source:MGI (curated);Acc:Fgf14-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705582..25705713 128
NO GENE  

 
Come back to gene ENSMUSG00000025551


For any suggestions or comments, please send an email to unitrap@crg.es