Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14606A5
Clone ID IST14606A5
Vector VICTR74
Project tigm

Sequence tag IST14606A5HMR1
Sequence
NCTACCGAGCTTCTACGTTACTGCTTGANAAACGCAACAGTGTATAAAGTGTATAAGATGGCAACAGTTCCCCAGCTTCC
TGCTAACCTGTTCCAGTAAGGGAAGGAAAGTAAGTGAACTCGGCACAGGACAAGCTCTGCTGGGAACTGAGCAGGCACAT
TACCGAAGGTAACAGACNGACCCCGTANCTATGTCNNGCTGGGANANTTACTCTTCTGAGCCCTGACAGACAN
Sequence Type genomic DNA
Unitrap ID UNI97

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12943343..12943573 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064070 (2810051F02Rik) RIKEN cDNA 2810051F02 gene Gene [Source:MGI Symbol;Acc:MGI:1919954]

 
Come back to gene ENSMUSG00000064070


For any suggestions or comments, please send an email to unitrap@crg.es