Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST439019
Clone ID OST439019
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST439019
Sequence
GGAGAGCAGTATTTCTTTACTTCTGATGTCTGCTGCCTCTGAGGATGGGAGTTATGAAGTGGAGAGCGTCCTTGGGAAGG
AGATGGGACCTTTACTCTGCTTTGTCCAGTCCATCACTACACAGCAGAGCAGCTGTGTCGTCACCCTGGAAGAGATTGAG
CTGCTGAGTACAGAGGGAGCCACNTGCTGCTCAGCCTCCTCCCTGACATCTGTGCGCTTGGCAAGGGGCNTGTGTGTTAA
CTCAGTGTTTCTGTTTTTAAATTTAGTGGGTTTCTTTTCTTTCTTTTTTCTGGTAAAGAGATTAATAGGATAGTTTTAAA
TTAAAAATCAAGATACCTCTAATACACATTTTTTTAAACTTTACCTTCCTACAAGTTTGATAACATGTTTCTTTGAGTGT
TTCTCATGTCTTCTGTGTCTTCATTTTGCAGCTACTTGGGCTTAGGAAATGTGCTTTGTTGTAGCTTTAAAGTAGTTACA
ATTTATCAATATTATATATGTTTCCC
Sequence Type mRNA
Unitrap ID UNI17647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15889427..15895284 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es