Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12141A7
Clone ID IST12141A7
Vector VICTR76
Project tigm

Sequence tag IST12141A7BBF1
Sequence
NNNTCTTAAGAACTGTTACTTAAAGCTAAGACAAAGTCACCAGGGAAGGTGAGAAGGAAACAATGGAATGGATCTGTCTT
AGTTTGGGTTTTACTGCTGTGAACAGGCACCATGACCAAGGCAACTCTTATAAGAACAACATTTAATTAGGGCTGGCTCA
CAGGTTCAGAGGTTCAGTCCATTATCATCAAGCAGGGCAGCATCCAGGCAGGCATGGTGCANGAGGAGCTGAGGGTTCTA
CATCTTGTCCTGGAGGCAAACAGGAGAAAACTCTTCCAGGCAGCTAGGACAAGGGTATTAAAGCCTATGCCCACAGTGAC
ACAACCGCTCCCTCTTCTCTCTTCTCCTTCCCTCCCCTCTCCTCCCCTCTCCTCTCTCCTTCCCTCNCCTTCCTGTCTGT
CCTCTCCCCTCNNTTTNNTTTTCTCCCCTTCNTTTCTTTCCTTTNNCNCCNNTNNNTTTA
Sequence Type genomic DNA
Unitrap ID UNI30577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119608903..119609343 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]

 
Come back to gene ENSMUSG00000020227


For any suggestions or comments, please send an email to unitrap@crg.es