Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14125H8
Clone ID IST14125H8
Vector VICTR74
Project tigm

Sequence tag IST14125H8HMR1
Sequence
NCTGTNNACACAAGGACNANAAAAGCATATTCNCCGGTGCTTTTGTGTACCATGTTGCTTCCTCTTAAGGTACAGTTCCC
TTTTCCGCTAACACCATTCNCACTGACCCATTCTTTAAAACTGTCCATTGCTGACACAGTTCTCAGCCTCCTTCATCTCC
CCATCTCCTAAGTGTTTCCATGAGCTCCACGGACTTTTGTTGAGTGTAGGTTTTGGGGTTTTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI22378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 77103861..77104080 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042272 (Sestd1) NM_175465 SEC14 and spectrin domains 1 Gene [Source:MGI (curated);Acc:Sestd1-002]


Sequence tag IST14125H8BBF1
Sequence
CTACTTTTCCCAAACTTAACGAGTTTATCAAAGTTCANTGACCTTCTACCTCATTGTATC
Sequence Type genomic DNA
Unitrap ID UNI30150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168591182..168591241 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es