Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13394C6
Clone ID IST13394C6
Vector VICTR74
Project tigm

Sequence tag IST13394C6HMF1
Sequence
TGTGTAACCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGACTGTCTCTGCCTCC
CAAGTGCTGGGATTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 76622324..76622418 95
 
EST/CDNA Est Name
  CA886236.1


Sequence tag IST13394C6BBF1
Sequence
TGTGTAACCCTGGCTGTCCTGGAACTCACTTTGTAAACCAGGCTGGCCTCAAACTCANAAATCC
Sequence Type genomic DNA
Unitrap ID UNI12044 UNI25342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75500215..75500278 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94596670..94596733 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 76622324..76622387 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 10271466..10271529 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 45120540..45120603 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 37231921..37231984 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24453244..24453307 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137623541..137623604 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88309663..88309726 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033216 (Eefsec) NM_023060 eukaryotic elongation factor, selenocysteine-tRNA-specific Gene [Source:MGI Symbol;Acc:MGI:2137092]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13455408..13455471 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127492128..127492191 60
NO GENE  

 
Come back to gene ENSMUSG00000033216


For any suggestions or comments, please send an email to unitrap@crg.es