Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST438844
Clone ID OST438844
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST438844
Sequence
CCCCGGCCCCTCCATTGCCGTTGAAGTTGAAGCTCCTCCAGTAGCCTACACCAAAGGAAAGGTTAGTTCCAGAACCGGCC
AAAGTTCCTGAAATTAAGCCAGCGATACCTCTCCCTGGACCTGAACCAAAGCCAAAGCCTGAGCCAGGT
Sequence Type mRNA
Unitrap ID UNI17655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76654598..76655130 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]

 
Come back to gene ENSMUSG00000051747


For any suggestions or comments, please send an email to unitrap@crg.es