Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST438833
Clone ID OST438833
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST438833
Sequence
GGACTATTCCATGGAATTTTAAAAAGCTGNGAATNNCTGGGCCAAAACCTNTGCCTTTCTTGGGGACGATTCTTGCTTAC
CAGAAGGGCTTCTGGGAATGTGACATACAATGTCATAAAAAATATGGGAAAATGTGGGGGTAAGTATTACAGCAACTTCT
ACTGGGTAGATTTGAAACATTTACAAAAGCTCACAGGATCTTCAGTGGAAGCAATGGTATTACAAAGATTTGTGGAGGCT
TTTCCTATCAAAGGCCCCATATGTCTTCCAGTGTCATGATTCACAGATGGAATTTTGTTAAAACAGTTGCATGTTTTGAT
TTTCTCCTGGACTTGATGGTTCAGGAGNGGTTCACTTGANNTAGNCCAGTGTCTGGATATTCCACTCTTCCAACGTNCTC
TTCTGCGTATCCCTCTAATACAATATAACGAATCACTCAAGACCTTTAAAAA
Sequence Type mRNA
Unitrap ID UNI17656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138358435..138360309 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029727 (Cyp3a13) NM_007819 cytochrome P450, family 3, subfamily a, polypeptide 13 Gene [Source:MGI (curated);Acc:Cyp3a13]

 
Come back to gene ENSMUSG00000029727


For any suggestions or comments, please send an email to unitrap@crg.es