Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14506A3
Clone ID IST14506A3
Vector VICTR74
Project tigm

Sequence tag IST14506A3HMR1
Sequence
AGGTAACAGCATCAGGTTTTAGTTGTCTGCTGCTGTGTCAGTGCCTCCATGATTGTCTTCTCCCTGAGGCTAGGGGAAGA
GCAAGAAGTTCTCAGCCGCCTGAGGAAGGAAGTTATGCCCTGGCATGAACTGCTGATCACTTGGCACTTGTAAGCATTAN
ATCACCATGCCTGCTACTTGGGAAGGTTCCGAAAGTGCTACCTAACTCTGCAGGATTCTTCATAAACTTGGAGTGGCACA
GGGAGTGATGTTACTGTATCCTGTTCNCNTANGTCNGTCNNGTTGCNCN
Sequence Type genomic DNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83295991..83296276 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]


Sequence tag IST14506A3HMF1
Sequence
CCTAACACCAAAGCAGAGTGAAAATGCCAGGGAGCACTCACTCACCTTCNAATTCTCTTTTTAGTATANANCANTCAGGT
TCCATAACATCGGTTAGCAGAGCCAGGAAAAAGAATCGGCCGTTACTAACACTGTTCTGTGAAACACCAACCAACTCCTA
CAAGTGGCATTTGATGTCTGANAAAGCAATTCTTCTGTACTATCGAATGGCAGAGTATTTTTCAGGGGATACTCAAAANN
NAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83295756..83295993 228
NO GENE  

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es