Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10082F8
Clone ID IST10082F8
Vector VICTR75
Project tigm

Sequence tag IST10082F8BBR1
Sequence
GAACCAAGAGAGCAACACCAGGAGAACCAGATTTCAAAGGAGAATCCTCGGACCAAGAGAGATCCAGGAGCGGAACCAGC
TAGAAGCCAAGAGGGCAAGAGGCCGGGAAACCAAGTAGCCTAAATGACTGAGGTTATATAGAGAAGCGAGGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTT
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84867759..84867942 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST10082F8BBF1
Sequence
GTTCGGGCTTCCTCCCTTTCACGCTCCCATCCCCCCTCCCACCAGCTGCCTCTGGCTGCTTTCTCATGTCTACAATAAAC
CTTCTCCTCCACCATATATAGGAGCCATTATGTCTTCACTTTAAAAAAAAAATTTCAAGGGGTGACTGGCAATTTAGTGA
GGCCCCCGAGAGAGAGAGGGAGAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84867578..84867762 181
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es