Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11570D10
Clone ID IST11570D10
Vector VICTR76
Project tigm

Sequence tag IST11570D10HMR1
Sequence
TGTGTGTATTCTAGGTAGCAATCCCTTCTAATATATATGACTTTCAGATACGTCTTCCAAGCCTATTGGTTGTCAGTGCT
GGGAATTGAGCAGGGCCCAGGAAGAGCTCTCAACTGCTCAACCCTCTCTAGCCCTTAAAAAATTGTTTTAAATGTATTGA
TAACGGATACAGATGAACGAGTTGCCTTGTGATACCTTGTGATTTATGTATACAGTTTTATGTACAAATCANGTTC
Sequence Type genomic DNA
Unitrap ID UNI29565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57820389..57820623 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019920 (Lims1) NM_026148 LIM and senescent cell antigen-like domains 1 Gene [Source:MGI (curated);Acc:Lims1-001]

 
Come back to gene ENSMUSG00000019920


For any suggestions or comments, please send an email to unitrap@crg.es