Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10950A5
Clone ID IST10950A5
Vector VICTR76
Project tigm

Sequence tag IST10950A5HMF1
Sequence
NGGAACTCACTCTGTANACNNGGCTGACCTCNAACTCANAAATCCGCCTACCTNTGCCTCCCAAGTGCTGGGATTAAAGG
CGTGCGCCACCACTGCCCGGCTCCACTGCTCTTTTGGGCTCCAGGTATATACCCCTTAAACCCTGTCATCCTGAAAGCCC
ATGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26243790..26243952 151
 
EST/CDNA Est Name
  BF720112.1 - BQ180651.1


Sequence tag IST10950A5HMR1
Sequence
CNGGACAGCCNGGGCTACACAGAGAAACCCTGTCTTGAAAAACCAAGAAAAAGAAAAAAGCGACATAAGATGTAGGTGTT
ATGAGACCCACATAAGCAACTGAGTCTGATAGGTGTGGAGGTAGAGGCTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI36423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26243658..26243788 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026927 (Sdccag3) NP_080839 serologically defined colon cancer antigen 3 Gene [Source:MGI (curated);Acc:Sdccag3-002]

 
Come back to gene ENSMUSG00000026927


For any suggestions or comments, please send an email to unitrap@crg.es