Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10330B10
Clone ID IST10330B10
Vector VICTR76
Project tigm

Sequence tag IST10330B10BBF1
Sequence
TTTGAGTTAGAATGGCTGGTCACACTGAAGAAAGGAGAAAAATCATTATGACTCTATTAAATGACTAATTTTACTAAGTC
TGAATATACAGTCTCTGATGTACTATTGCCATAAAGTTAAAAGGCTAGAAGCTAGTCTAAACTGGAAAAATGACAAGTAA
GGATGGATCTAAAACATGAATTTAATTTAGTTTTTTAGTCNATACAATCAGGACATGAGTCAACTTACCTACCANCTCGT
CACACGAATTAATATGTTTTTGAAGCGTTTTGTGGANAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCTGTTTNAGGA
TCNATCTATAAGCNNATAAGTAGATCCCTTTAAGATACTATAANGCATTTATNAAACTCTTTGACATTAAAATATTANAT
TTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGANATACAATTTCTCTCTTT
TTTGTCTTTTAAGAANTTAAAGTTTTAAAATTTTACAATACCTAANNCTTTGAN
Sequence Type genomic DNA
Unitrap ID UNI15589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469517..7470048 504
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940243..136940774 504
 
EST/CDNA Est Name
  BG073349.2 - AW549398.2 - AW549465.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777148..115777679 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  


Sequence tag IST10330B10HMF2
Sequence
TTTGAGTTAGAATGGCTGGTCACACTGAAGAAAGGAGAAAAATCATTATGACTCTATTAAATGACTAATTTTACTAAGTC
TGAATATACAGTCTCTGATGTACTATTGCCATAAAGTTAAAAGGCTAGAAGCTAGTCTAAACTGGAAAAATGACAAGTAA
GGATGGATCTAAAACATGAATTTAATTTANTTTTTTAGTCAATACAATCAGGACATGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI30626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469826..7470048 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29591841..29592063 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 15070053..15070275 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81750968..81751190 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95203117..95203339 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77223788..77224010 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356080..91356302 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108034497..108034719 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 254216..254438 221
NO GENE  

 
Come back to gene ENSMUSG00000028399


For any suggestions or comments, please send an email to unitrap@crg.es