Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12107C11
Clone ID IST12107C11
Vector VICTR76
Project tigm

Sequence tag IST12107C11BBF1
Sequence
CTGTCTTGATCTTACATGAGTTATTACATACATTTCCAGGCTAGGTTAAAAAGTTAACACGTGCACCATCACCAAGCAGT
AGGTAAAATGGTTATCCCCTTTCATTTCTGCTGTAGGAAAGCAACTGCTTGCTTGC
Sequence Type genomic DNA
Unitrap ID UNI14045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86399690..86399825 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es