Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14225G9
Clone ID IST14225G9
Vector VICTR74
Project tigm

Sequence tag IST14225G9BBF1
Sequence
CCTGTNNACNAGACTAATGTCAAACTCAANANACCCACCTGTCTCTACCTCCCAAGAGCTGGGATTAAAGGCACGTACTA
CCACGGCCCANTCCATGTCTACATTATTAAATAATCACTACAATCATGCTAGTTAACAAATTCTTACTTTTATGGTATGT
TGTGTGTGTGCATGAGTCTATGTACTGAGTANATTTAATTTAGTATTAATCTGTGCTGGTGTATANCTCANCAGGTTTTA
ATTTACACGTCAAAATCTCNGGGTTCAATTCCCTGAACAGCCCCTCCTCTGAAACAAACTATTCTAATCNATAACATAAN
GTTGGGGNANGNTTTTGTGCACTGTGTATTCAGATGCTGATTTCTATGCCCAGACATCTGGTTGCAAGGTCAAGCATCTC
TGGTCTCANTGTTNTGTNAAAATTGTTTTCTATCANCNCNGATTGNTTANTANNNGGATAANCNANNNANCTNNGTNNAN
NANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14225G9HMF1
Sequence
CCTGTAGACCNGACTAATGTCAAACTCAAGAGACCCACCTGTCTCTACCTCCCAAGAGCTGGGATTAAAGGCACGTACTA
CCACGGCCCAGTCCATGTCTACATTATTAAATAATCACTACAATCATGCTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96131128..96131261 132
NO GENE  


Sequence tag IST14225G9HMR1
Sequence
NNGACAGTCNGGGCTACAAAGAGAAACCTTGTCTCAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI11446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96131261..96131300 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

 
Come back to gene ENSMUSG00000032411


For any suggestions or comments, please send an email to unitrap@crg.es