Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12537H12
Clone ID IST12537H12
Vector VICTR76
Project tigm

Sequence tag IST12537H12BBF1
Sequence
GCACTGANNNNNNACTTATATAACCGAGTCAGAGTCAGAGCACATGGGGCCCTCGAAGAGCTGGTTGTGGCTCATGGGTT
ATCTGTGAATGCCAACATCCCTGCAGCAGCAGACATCATTGTGTGGCTGAGTCCTGCAGCAGGATCTAACTAAAGAGCCT
GTACTGACAAACTGCAGAAATGGATGATGCCCTACTCATGATTTGCTCACCAGAAGATGAACACAGAGATTGGGGCTCAT
CTTGAAGTTTTGCTTTGGGCGGTGGCGGGGGTCGGGGGGTAATTTCTAAATAACATGTTATAACCAACCAGTCCTGCCCT
GGTTTTCTTGGAGCACCCTGGGGTATTAGGAGCTGCCATGCANGGTTTGATAGTTGAAAGAGATGGGAAATTGACTGAGT
TCTTANTATTTTATATAGCTCCCCATTTCACACACAGAAAAAATTGATTCN
Sequence Type genomic DNA
Unitrap ID UNI33120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 68137137..68137586 434
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027030 (Stk39) NM_016866 serine/threonine kinase 39, STE20/SPS1 homolog (yeast) Gene [Source:MGI (curated);Acc:Stk39-001]

 
Come back to gene ENSMUSG00000027030


For any suggestions or comments, please send an email to unitrap@crg.es