Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14983B8
Clone ID IST14983B8
Vector VICTR76
Project tigm

Sequence tag IST14983B8BBF1
Sequence
AACTTATTAACTAAACTTCTGACCATTTGTTCTTTTTATCTCAATGTTTTCTGCCTTAATGTCTCATTGTAACAAGAGCT
AAATGAGATTGAGTTTACACGGCTGTCGTCATGATCACTGGCTACTGTCTGTACTACTGGTGAAAGCTATACATGCTCGT
CCCACTGGTCTACCTTACCAGCCCCTGGCATCTCTCAAGTAAAAATTTCCAGTTATTATATTATATATTCCAAGTTGCAT
ATGAACTTACTCAGAAACTCCCAGTATTTTTTATAGTCAGCTGGAAATTTTCNTAATTGCAACTGATAGAAATTCTCTTT
ATTTGGAGAGCTCAGCCATTCCTGTGCCACCTACACAAAGCAAAAGAAGAAACTAAGAAATAAAGAACATGCTAAAAGCT
ACNACNAACAAACAGCAAAATGTTCCAGTGGGCTAAAGGAAAACAGAACAGATCCCAAGTGAAAACCTAAGANTCAGTCT
GTGAGGTTTATAAAGTTGTCCACAACTGTCCTGNCCNATTTANCAGCCNTTAGTCNCATTTGGTTATATTTGTTAACTGN
NCTTTTAAANGCTAAAAAATNCNNNTNCTNNNTTNNAANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29005298..29005877 556
NO GENE  


Sequence tag IST14983B8HMR1
Sequence
AGTTCTGTAATTTTANTGCATGTGTGTGTGATATATANAGAAAATATGAACAGATAAAANGTANACTGTACATGTGACTG
GATTGTTTTGTTTTTTTGAGGTAGCCTCTTCTGTGTGTGTCTCCCTGGCTGTCTTGGAACTCAATAGTAGACCAGGCTGC
CCTCATTTCACAAAGATCTGCTTGCCTCTGCTTCCCTGAGTGCTGANATTCAAGGCACACTGCACACAACACACCTGACT
TTTGC
Sequence Type genomic DNA
Unitrap ID UNI12230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29005874..29006117 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es