Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11747E5
Clone ID IST11747E5
Vector VICTR76
Project tigm

Sequence tag IST11747E5BBF1
Sequence
GTCTGTGTGCTCTGTTTGAGCTCGGCCCCTTCTCACACTGCGCACGTTGGCTTGACCTGGCTTACACACTCTCCTGCCTC
ACTCATCTCAGGTGTGAGTCACTATGTGCTGCTGCAGTTCTCGTTCTCTTTTTGTCTTTTTTTTCTTTTCTTTTTTTTTA
AAAGTAATTACTGTTTGTCAGGAANTCTGTCTTCTGTTTGTGCTAACATATACTTAGGTACAAAACCNTGGGNAACACAT
GAAATCNNTTTTGANTTCTGAACTTTTGAGGTTTTTCTTTTAAAAGTTNANGATTGATTTTTGTTGTTTTGNGACCCTCC
CTCCTACCCCCCCCCCCNNAN
Sequence Type genomic DNA
Unitrap ID UNI13547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86403478..86403814 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es