Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST438580
Clone ID OST438580
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST438580
Sequence
GACTGAGGTGGGGTCTTTNAAGCCTTTGGAGAAGGTGCTACTGGAAGAAGGGTCTGCCCACAGACTGGTCGACTCCCCAG
CCACCCCCATCTGGCAGCTGATCTCCAAAGTCCTGGCCCGTCACTTCAGTGTAGCAGATGCCAGCAGGGTCCTGGAACAA
CTACAGAGGGATTATGACAGGTCCTTGAGCCGCCTAACACTGGATGACATCGAACGTTTGGCCAGCCGCTTTCTACACCC
TGAAGTGACTGAGGCTATGGAAAAAGGGTTCTGCAAATAGCATTCTGGGATTGTGGGGAGAAATCCCAGGTCAGGCCACA
GCTGCATGTTGCATTAAATGTGTTCTCATGTCGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71612740..71613189 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015290 (Ubl4) NP_663380 ubiquitin-like 4 Gene [Source:MGI (curated);Acc:Ubl4-001]

 
Come back to gene ENSMUSG00000015290


For any suggestions or comments, please send an email to unitrap@crg.es