Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11825F10
Clone ID IST11825F10
Vector VICTR76
Project tigm

Sequence tag IST11825F10BBF1
Sequence
GGAGGAGCTGATAGAATCTAGAAAATTTAACTCGCCCCAGTGTAGCCGTTGGTACCACTGCTGCTCTCTCATTAGAGAAT
TTTAAGTCCCCTGGGAAAAGCTGAATTATAAAACAGCTCTTATTGAGAATGTGTCTGATGAAGACATTGATGTCCAGACC
TGAGTTCCTATATCCCCGGATACATTACCTCTTCTCTGATCCTTATCTTTAAATTCCCAGCCCTGGGGAGGTAGAAGCAG
GTGGATCTATCTGAGTTCGAGGTCTACATAGAAAGTTCCAGGACAGCAAGAGCTACATGCAGAGACCCTGTCTCTTAATT
AATTAATTAATTAATTAAATTTAATTAATTTAATTAAGTANAGATGGTAACTAACACACTAGATTCCTCAATANATCTG
Sequence Type genomic DNA
Unitrap ID UNI22257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88358530..88358927 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es