Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10567A7
Clone ID IST10567A7
Vector VICTR76
Project tigm

Sequence tag IST10567A7BBF1
Sequence
NAANATTCTCAGCCACAGCAGCAAGCTCTCCTGGGCCCCAGCTCCGTTTGTGCCAGGTGTCTGGGCTGTTGCCGCTGCGG
CCAGGGTCTTCCCTTCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69500414..69500510 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST10567A7HMF2
Sequence
CTTGGAGAGAAAAGAAAGAGGAGGAGAAGAAAAAATAATCAGCTCAAAGCTATTAAATATCAGCCGCGAGCCTCGTGATT
GGCTTTAAAGGCAGCAGTGAGGTTAGCAACAGTCAGAAACGCTAGGCTCCTGCCTCTTCCTGCCTGTAACGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88396403..88396554 148
NO GENE  

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es