Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12860C10
Clone ID IST12860C10
Vector VICTR76
Project tigm

Sequence tag IST12860C10HMR1
Sequence
NACGAGTAGGTTGTGCCAACGCCAGGTGCGCAGGGGGTCGGTTTGCACGTGTGCAGGCTGGGGCAGGCGACAGAGCACGC
GCCGGAGTGCCCGGAAGGTCAGCGTGGCGCCCAGGAGCAGCGGCCAGGCGGGGTGGAACAGTAGGGGCATGCTGACCCTT
CCTGCCGTCTGTCTGTCCGCCCCTTAANCCGTCTCCTCCGACAGTTCTGGGAACACCGTTCCTTCTCTGGCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77992282..77992513 230
NO GENE  


Sequence tag IST12860C10HMF2
Sequence
GTCTCTTTCACCCACTCCATTGTATCAGGGATCTGGGCACTGCTGTGGTGAGTGAACAACCCGGGGTAAATGAGATGGCC
GTGGGATCTTTCGCGGGGTGCTCGGACTGGGCTCCCTCTTGCTATTCCCATCACGGGTGAACAGACGCCAAGGATCTCAC
CTGATTCCGTTTGGAAAACTACCCAACCAAGAACGGCTGTGGGAAACCCAAGGTACCTGGGCTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI35453

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77992512..77992738 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019437 (Tlcd1) NM_026708 TLC domain containing 1 Gene [Source:MGI (curated);Acc:Tlcd1-001]

 
Come back to gene ENSMUSG00000019437


For any suggestions or comments, please send an email to unitrap@crg.es