Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0164
Clone ID AG0164
Vector pGT0lxr
Project sanger

Sequence tag AG0164
Sequence
TTTTTTGGTTGTGGGTTTTTTGGAAGGGTTTTTTTTTTGTCATGGCGGCTTTCCGCGACATGGTGGAGGTGAGCAACTGG
CTACTGAGCCTGCTGGGGGCCAACCGCGCCGAGGCGCAGCAGCGGCGGCTGCTCGGGAGCTACGAGCAGATGATGGAGCG
GCTGCTGGAGATGCAGGACGGCGCCTACCGGCAGCTTCGGG
Sequence Type mRNA
Unitrap ID UNI3402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21564563..21564725 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074476 (Spc24) NM_026282 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914879]

 
Come back to gene ENSMUSG00000074476


For any suggestions or comments, please send an email to unitrap@crg.es