Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14786A12
Clone ID IST14786A12
Vector VICTR76
Project tigm

Sequence tag IST14786A12BBF2
Sequence
NTATCTCAGCCTGTGCTTTTAAGTTTTAACATAACTATATGACCTTAACTTATGACCCTTCTANATGAACACACAAAAGA
TACCCATTTTTANTATGAATGGACATAAAACTAGTCATCTACAAGTGGACACCTGATTTCCTGTCTTTATCCATAGATGA
TGTTGCANTGTATAATTAATACCCTAGTCCTTTCATTCTTTTGCAGATGTATTTGTTTCTATGAACAGAATTGTTATAAA
TAAGGCATACATACACTTGTACGTTTANAAGTCNTTGCTCCNTTTTTCTCCCCANNNAATATGTCTGTTTCCAACCTCAC
TATCACTTTTGGTGGCNAGCTGGGGGTTGCNNNCNAGTGGCNNGATGCCTCTGGGAANCCNTCNNNGNGNCNANGCCTCC
GGGAATTNNCNNTGNCNGNNCTNTAGANGTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14786A12HMF3
Sequence
GTATCTCAGCCTGTGCTTTTAAGTTTTAACATAACTATATGACCTTAACTTATGACCCTTCTAGATGAACACACAAAAGA
TACCCATTTTTAGTATGAATGGACATAAAACTAGTCATCTACAAGTGGACACCTGATTTCCTGTCTTTATCCATAGATGA
TGTTGCAGTGTATAATTAATACCCTAGTCCTTTCATTCTTTTGCAGATGTATTTGTTTCTATGAACAGAATTGTTATAAA
TAAGGCATACATACACTTGTACGTTTAGAAGTCATTGCTCCATTTTTCTCCCCAGACAATATGTCTGTTTCCAACCTCAC
TATCACTTTTGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28342077..28342411 335
NO GENE  


Sequence tag IST14786A12HMR1
Sequence
TAAGTAGCTATAAGTTTACTTGGGTATTANTAATAAGTGCTATTTTGGAGGAAACTAGGAATTTAAGTATCAGTCTTCTC
TCTTCTGTTCATAAAAATGCCTTGCTAGCCAGAGATAGTAGATGTATAAGGTATATATGCTCCAAATCTCTGTGCTGTAG
CACCCTCAAAATAGGTGGACTGAGAAGTCNAGGGTTGCTATAANCACTTGTTGCTCTTGGAGAGAACCCANNTCAACTCC
CAGCCACTACCNCGTGGTAGGTANTTC
Sequence Type genomic DNA
Unitrap ID UNI214

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108457106..108457371 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es