Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606E12
Clone ID IST13606E12
Vector VICTR74
Project tigm

Sequence tag IST13606E12BBF1
Sequence
GGGTAAGGCCCACCTCTGAGTTTGTAGGTGGATGGTTAAGGGTTTATTTTTAAAGATTTATTTATTTCATTTATGAGTAC
ACTGTANCTGTCTTCANACACACCNNAANAGGGCATCNNACCCCATTACNNATGGTTGTGAGCCACNATGTGGTTGCNGN
NATTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13606E12HMR1
Sequence
ACCCAACTGTAAGCAAATCTTTTACAGGGACNAGAAAGGGCTTGCTGAGCACTGCCGAGGACCACGTAGTTTTGGGTAGT
AGTAGCTTTTCAGTTATTTCATTATTGGCACACTCAACTTCTTGGCTCTCAGAGGAAGGTGAGTGTTTGGGTACGTCTAG
GGCATCTAGGACTTAGGGCCTGTGGAGGACATGGGGAGAAGAAAAAGTTAAGGCNAAGATGGGTTGAGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857226..97857457 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es