Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12831B10
Clone ID IST12831B10
Vector VICTR76
Project tigm

Sequence tag IST12831B10HMF1
Sequence
GATCTCCCACTGTAGCCCAGAATATCCTGGAACTCCCCACAGTCCTCCTGCCTTAGCCTCCCAAGCAATTCGCCTCTCTC
CAGCTTTGGCAGTGGGGGAGGGGTATGTTTAAATTGGCTTTAGGAGGGTGTGTGTGTATGGTATGTATGTATGCGTGCAT
GTATGTGCCTGCAACATGTGTCTCTGTGTATTTGTGTATATGCCTACATATGTGTGTATATGTGTATGCATGTGTATGTG
TGAGTGTCTGTANATGTATGTGTTGGTCTGTGTGCTTGTGGATGTGTGTCTATCTGTACACACATGCACAAGCAGGTAAC
TGTTTTGGAACTCTCCATGCTGGTTCCTGGAGTGGTGTGTANCCCTTCCAGCGTGTGGGTCCTTGCCTGCACACTGTCCA
GATAGTCCCTGTCCCAATCATTTTCTCACATATNNGGGANACAGAAGTGTGCAGCTGGAAATTCTGCACCCCC
Sequence Type genomic DNA
Unitrap ID UNI34616

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150369142..150369613 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029658 (4930434E21Rik) NM_029440 RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]


Sequence tag IST12831B10HMR1
Sequence
NANNATGTTTNAAAANNAAATAAATATAAATTAATTAATAAACTAATAGACAAAGCCCGCCTGACGGATGTATGTATGCA
TCAAACCATGAGAGGAGCCGACCTTGACTGTGTTGTCAGCAGACATGGAAAACACTTTGTTTTCTTCAAAGGCGACGTGT
ACATACATCACCGGAGCCCGGTGGCCTCTCAGCACACCTGTTGGCTTTCTANAAAGAGAAAAGGGCAAACAGCACAAAGC
CATTCTGTCTGCTGCTGCTCCTATTTTAAAAATGCAAAACTCANCTTGGCCCAGATGTGGCGGCTCTATTCNGCCTGGAG
GAGGCTTACGCTTCCCTCTGATAGTANNNNNTCNANATTCTGAGTAATAAAAGGACTGANGCNNAATAATAAGCANTTNN
NNNAANNGANCTCGGGGTNNANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029658


For any suggestions or comments, please send an email to unitrap@crg.es