Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13192B4
Clone ID IST13192B4
Vector VICTR74
Project tigm

Sequence tag IST13192B4HMR1
Sequence
AGATGTCCTTCAGGTTAGTAGTCTGTCTTTCTTTCAAGGCAGCCTTGTGGAAGTCACTGAGGATAGGATAGAGATGAGCA
AACACAGGCTCAGGACGAGCTACTGCGTGTAGAGCATTGGTGATTCAGTGCTGAATTTCTCGCCTTCCCAGAGTGCATAT
AGGAAGGCGTATGTATTTGGAACTGCTGGTGAAAGGTTTGGAGGCTGCTCACTTGGGGACCTTCCCTCCCCTTGTAGTTA
GTCTTGTGTTTATACGTAAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91575461..91575724 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es