Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10986G6
Clone ID IST10986G6
Vector VICTR76
Project tigm

Sequence tag IST10986G6HMF1
Sequence
AGATGCACACATGTCTGGAGCAGACGGTGTTTTTAACATAAGTTTCTTTACTGCATATTGTACTAGGGCGTTCACAAATG
TGCTAATGCAATAGGCAGAGGGTTTTCTTTCTCCTTTGTATTCTCTATCCTTCCCTCCTCTCTCCCCTGTCCCTCCCTCC
CTATTTCTTCTTCCTTCTCTTTCTCTCTTCACTGGGGATTAAAACAGGGCCTTGCAATTGCTAAACACGTGTCACCACAG
AGTCATCCCTTCAGTTCCCTCGGGCAAAGATCATTANGCTTACAGCTANAACACTNNNNTANTATTTANNANTATTAATA
ATAAAAGTTGGGTGTGGTGGTTA

Sequence Type genomic DNA
Unitrap ID UNI27501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12400622..12400963 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]


Sequence tag IST10986G6HMR1
Sequence
ATCTCTTGCAAAGCGATTCNCCGCAAGAATAGAATAGCACTGCCTCGGTCTTTTCCCATACAAATATAAAAATTTTAAAG
ACTCAATTTAGATGCCTCCCGTTTGATCGTGCAAGTGACTGCTCAGTGTCACAATATCCGATTCAAGATCTAATTTGTAA
GCTCAGTTCCCAAATTAGACACGTGGACCACCCCCATGAACTTTACCTTCCACTGAGATGTCCTGAATGGCGAAGCGGAG
GATGATGGTCCANATCATACCCAGGGTCATCTTCACATTGCCATCGACTATTTCTGTGGGCGANAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12400960..12401267 298
 
EST/CDNA Est Name
  BF116984.1 - BE306078.1


Sequence tag IST10986G6BBF1
Sequence
AGATGCACACATGTCTGGAGCAGACGGTGTTTTTAACATAAGTTTCTTTACTGCATATTGTACTAGGGCGTTCACAAATG
TGCTAATGCAATAGGCAGAGGGTTTTCTTTCTCCTTTGTATTCTCTATCCTTCCCTCCTNTNTCCCCTGTCCCTCCCTCC
CTATTTCTTNTTCCTTCTCTTTCTCTCTTCACTGGGGATTAAAACAGGGCCTTGCAATTGCTAAACACGTGTCACCACAG
AGTCATCCCTTCT

Sequence Type genomic DNA
Unitrap ID UNI27501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12400712..12400963 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]

 
Come back to gene ENSMUSG00000052374


For any suggestions or comments, please send an email to unitrap@crg.es