Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14614E5
Clone ID IST14614E5
Vector VICTR74
Project tigm

Sequence tag IST14614E5HMR1
Sequence
CAGGAGTGCTTGGCTACTGTGGAAACCCTGATTTGATCTCTAGCACTACTTAAACCCACTGAGGCTGTGTACACCTCTAC
ATATCCCCAACATTTGGGAGGTGAAGGAATCCCCATGGAGGATCACATGGTGAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3167732..3167868 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]


Sequence tag IST14614E5BBF1
Sequence
CTGTCAACTGAGCTGAATCCCCATAACCTGGTCTGGTTTGTTATAAGGGACATTTGGGCTGAAATCCCAAAACTCAGGAG
ATTGGCATAAACAGTTGCCAAGAGTCTGAGGTTACCCTGGGACCCTGCAGACTGAGACCCTGTCTTTAGAAAAGTAAATA
AACTAAAATGAATAAATGACATTTAGACAAATATCATGTCGCTAGCCTATAATCCCTGCATTCAAGAGGCTGAGGCAGAA
AAAACAAAAAGAAAAAGAAATGATCCCAAGGTGGCCTATGAACCAGTTCCCCACCCTCCTGGTATGTATACACTTANTAA
AAACCAAAAGATATCAAAGTAAGTAAGTGGATGGACTCGGTTTTTTAAAGGATAGCAAACGGNTAACTAGAGANNANANN
CNAGTCTGGNTGGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3167866..3168279 396
 
EST/CDNA Est Name
  CN680921.1 - CF897563.1 - CN677414.1 - CF896149.1 - CD539023.1 - CD539788.1 - CA544139.1 - CN682711.1 - CD562901.1 - CF162959.1 - CN672183.1 - CN673034.1 - CN675717.1 - BB839479.1 - BB839190.1 - BB839109.1 - BY004856.1 - BY032049.1 - BB838697.1 - BB839238

 
Come back to gene CN680921.1 - CF897563.1 - CN677414.1 - CF896149.1 - CD539023.1 - CD539788.1 - CA544139.1 - CN682711.1 - CD562901.1 - CF162959.1 - CN672183.1 - CN673034.1 - CN675717.1 - BB839479.1 - BB839190.1 - BB839109.1 - BY004856.1 - BY032049.1 - BB838697.1 - BB839238


For any suggestions or comments, please send an email to unitrap@crg.es