Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12756E1
Clone ID IST12756E1
Vector VICTR76
Project tigm

Sequence tag IST12756E1HMF1
Sequence
ACCTCAATGCCCAGANCCCATTCTATCCTATTCATATGTGCACCACCCAAGCCCTACCCCATCTGAATTTCCTAACACTG
TTGCTCTATCCCCATCTATCTAGGTGTGCCCAAGTANATTCTCACCAAGAGGGCTAACTCCTCAAGGTTCATTTATGTAT
TTCCTCCTCTGGGGGAAAAAGTGTAAATTCACTTTGTCCAGAGTTCATTCATCTCTCCATTCTCAGTGTTCTCCTAATGT
CCTCTGCACATGTTATTTCAACATTAACCATCTTCTTCTGTAATTGTTTCNNTCCCCACTGGGCTGCATTTTTCCCCTAN
GGCAAGATTTCTTTTTAAACTCTGTTTATCTTTCTCTCCNNAACCTAACAATGTGTCTGACACTCAGCTGACATTCNACA
AATGTCTCCNGCTAATTNGTCNCCATGACTTGTTAAACCTNACTGGGGAA
Sequence Type genomic DNA
Unitrap ID UNI30680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109040324..109040772 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es