Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12356E2
Clone ID IST12356E2
Vector VICTR76
Project tigm

Sequence tag IST12356E2BBF1
Sequence
ATGTACATTTAAGTATGTAGAGGATGTTACAGAAGAATATATGTAGATAATACAAAGGACACCGTACTAGAACAAATTAA
CATACCTCTTGTCTCCCCTTTGTGGTGGCAAGAAGCTGTTCTTGTACCATTTAGCAAGAATTCCAAATTCCAGGGCTGGA
GAGGTGGCTTANAAGTCAAGGTTACGTGTTGCTCTTGCAGAGAATCCTTGTTCCCAGCACCCATGTGATGGCTTACAACC
ATCCATAACTCCAGTTCCAGGAATGCCNNTGTCNTCNNNNNACCTCCAANANTACCAAGCACACNGTAATTCATCACGCC
CGGCTCTCTTGGTATTTTTAAGGCAGGATTTCTCTNNNNNNCCCTGGCTGTCCTGNAACTNACTCTGTTGACNANANNNA
NNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12356E2HMF1
Sequence
ATGTACATTTAANNNNNNNCNNNANGNNANNNNNNANNTCNGGNNNNNNNGNNNNNNGNTTTCATANTANAACAAATTAA
CATACCTCTTGTCTCCCCTTTGTGGTGGCAAGAAGCTGTTCTTGTACCATTTAGCAAGAATTCCAAATTCCAGGGCTGGA
GAGGTGGCTTAGAAGTCAAGGTTACGTGTTGCTCTTGCAGAGAATCCTTGTTCCCAGCACCCATGTGATGGCTTACAACC
ATCCATAACTCCAGTTCCAGGAATGCCAGTGTCTTCTTCTGACCTCCAAGAGTACCAAGCACACAGTAATTCATCACGCC
CGGCTCTCTTGGTATTTTTAAGGCAGGATTTCTCTATGTAACCCTGGCTGTCCTGGAACTCACTCTGTTA
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62242465..62242789 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es