Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11714A2
Clone ID IST11714A2
Vector VICTR76
Project tigm

Sequence tag IST11714A2HMF1
Sequence
ATGTGCACAAGTCAAACTAAAAGATGGACATAAAAGACAAACACAAANNNAGGAGGAAAGAAAAAAAGAATACTANGNNN
NGCACANGGNGNNNGGAGACCTGGGAGATCAGGGTGAAATTAAAGAATGTTAAAGGAAAATGANAAAAGACNTANAGGCA
AAGGCNGACNGTTGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11714A2HMR1
Sequence
ACATCAAANNNNCCTCTAAGTATGGAATGCCCCAAGACTAAGACTCCGCTCTTAGAGTGCCTCCTCTGTTCTTACTTGCT
ACCTAGGGGATCTTAATTTGTGTTTTTTCTTTTTGGTGATGATGGTCCTACTTATTTCAGCCAGACTTGGTATAGTANAT
AGAGCCTTTTCCCTCAATTTTTGATGTTTAATANTTAN
Sequence Type genomic DNA
Unitrap ID UNI3195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9141376..9141572 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es