Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST438239
Clone ID OST438239
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST438239
Sequence
GAGTAAATTTGTCTGCAGCTCAGACTCTGAGAGCCGCTTTCATTAAGGCTGAAAAGGAAAATCCAGGCCTCACACAAGAC
ATCATTATGAAAATATTAGAGAAAAAAAGTGTAGAAGTTAACTTCACCGAGTCCCTCCTTCGTATGGCAGCTGATGACGT
AGAAGAGTACATGATTGAGCGGCCAGAGCCAGAATTCCAGGACCTAAATGAAAAGGCACGGGCACTTAAACAGATTCTCA
GTAAGATTCCTGATGAGATCAATGACAGAGTGAGGTTTCTG
Sequence Type mRNA
Unitrap ID UNI17682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 75331521..75337509 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027835 (Pdcd10) NM_019745 programmed cell death 10 Gene [Source:MGI Symbol;Acc:MGI:1928396]

 
Come back to gene ENSMUSG00000027835


For any suggestions or comments, please send an email to unitrap@crg.es