Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14872E2
Clone ID IST14872E2
Vector VICTR76
Project tigm

Sequence tag IST14872E2HMF1
Sequence
GCCNCACTTTCTAATAGTGCCACTCCCCGGGCCAAGCATATTCAAACACTTTCCCTTCCCTTCTCTTCCCAAAACTTCCC
TTCCCCCTCCCTTTCTTCTCTTTCTTCTTTCACAGCAGTGTCTCCCTATGTAGCCCAGGCTGCCTCCACTCTCTCAATCC
TCCTGCCTCAACCCACTAAGTGCTGGGATTATAGATGGGCTTAGCACCAGGATGTCCTTTGCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 135208253..135208478 224
NO GENE  


Sequence tag IST14872E2BBF2
Sequence
CTACAGTGTACTAACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI35452 UNI36435 UNI36436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81506351..81506389 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 81509326..81509364 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049106 (Wdr22) NM_177267 WD repeat domain 22 Gene [Source:MGI Symbol;Acc:MGI:2444785]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93179857..93179895 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30019794..30019832 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024810 (Il33) NM_133775 interleukin 33 Gene [Source:MGI (curated);Acc:Il33-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165805535..165805573 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6576233..6576271 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33454363..33454401 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 28362948..28362986 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 86534679..86534717 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 88021591..88021629 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121278356..121278394 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 151783915..151783953 39
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es