Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14193C11
Clone ID IST14193C11
Vector VICTR74
Project tigm

Sequence tag IST14193C11BBF1
Sequence
TTCCGAAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCCGTAATGTGATCTGATGCCCTCTTCT
GGTGTATCTAAAGACAGCTACAGTGGGGCCAAGGGCTTCCAAGGCTGTGGGTTATGGGAAGCTCTAAGGACAGAGGGCCA
ATGAAGGCTGTGGATATGCACAGTGGAGACTCTTTTAGTTACTGTATTGACATTGCCTGCACTGTGTATTGCTCANACAG
GATGTGCTGGGCACTAAAGATCATGCTGCCCTGGCACCCAAGTGTTAAGGTCAGCCCTTCAACCCTCTGCTTGACCATGT
GAGCATCCTGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60645094..60645425 330
NO GENE  


Sequence tag IST14193C11HMF1
Sequence
TTCCGAAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCCGTAATGTGATCTGATGCCCTCTTCT
GGTGTATCTAAAGACAGCTACAGTGGGGCCAAGGGCTTCCAAGGCTGTGGGTTATGGGAAGCTCTAAGGACAGAGGGCCA
ATGAAGGCTGTGGATATGCACAGTGGAGACTCTTTTAGTTACTGTATTGACATTGCCTGCACTGTGTATTGCTCAGACAG
GATGTGCTGGGCACTAAAGATCATGCTGCCCTGGCACCCAAGTGTTAAGGTCAGCCCTTCAACCCTCTGCTTGACCATGT
GAGCATCCTGGATCCCAAACATGAGATCCTGCCCACCACCACCATCTCANANCAAAAAGGTGGGAAGCCNGANCCAACTA
ACATGTCCCANTCANTGCCTACAGGGTCTTANCANCTGTGTCTGGAGNCTGGCTGTTGTCCTGTAAAGACNTTNNATAAA
ATATCGNNNAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60644940..60645425 462
NO GENE  


Sequence tag IST14193C11HMR1
Sequence
GAAGAGCAGTCAGTGCTCTTAACTAATGAGACATCTCTCCAGCCCCGTACTTACTACTTTTAGTGGAATTGCCTGTAAAG
ACTTTTCAGTCTTGTAACCCTGTAGGGGTAGTGGAAAGCTTTAGAGAAGTAGCAGGTGGCAAGGGACCCCTTAGTGATAA
GGTTTGAATTANGCATCAAGACCTACTTGTTTTAGAAGTGCAGGAAGGGAAACTAACTGGAGTACCCACCACTATCTGTC
TATTGNNNAN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60645423..60645667 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es