Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568B9
Clone ID IST14568B9
Vector VICTR74
Project tigm

Sequence tag IST14568B9HMF3
Sequence
AANNNNAAGAAACCAAACAATTATGGCTGCCTGCCTGCCTGCCTGCCTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181665943..181665984 42
NO GENE  


Sequence tag IST14568B9HMR1
Sequence
GTTTGATAGACAGNCAGACAGACAGACAGACAGACAGACTCACAAACACAGAATAATAAAATCACGTCCTCAATAATTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14568B9BBF2
Sequence
CTGGGTTCGGGTTTTGACATGTGGATTTGGGGGAATCAAACGTGCAGCCCAAAAATAGGAAAGAAAGCATTATTCTGCAG
TTGGGGTAGGACATCTGGCAGTANAGGATCTTGGGAAAGAGATACCCATCAGTCTTCGCTTCCCCAGTAGTCTCACAATA
TAATCCAAGAGCAGGCAGAGCCTCTTTGATAATTCAAGCCAAGTCCTCAGGGGATCTCTGTGGCCAGTACATGAGGAGAA
GGTTAGGATAATTTAATATAGCAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGA
Sequence Type genomic DNA
Unitrap ID UNI36437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150389213..150389534 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029658 (4930434E21Rik) NM_029440 RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]

 
Come back to gene ENSMUSG00000029658


For any suggestions or comments, please send an email to unitrap@crg.es