Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14132B10
Clone ID IST14132B10
Vector VICTR74
Project tigm

Sequence tag IST14132B10BBF1
Sequence
CCAGGAGAATGCGGAGCAGCGGTTCTCAACCTTCCTAATGCTGAGACCCTTTAATGCAGTTCCTCATGCCACAGTGACCC
TCCCCAAACAAAAAATTTTGTTGCTACTTCACCATTTTAATTCTACTACTGTTATGAATCATAATGTAAATATATGTTAT
GTAGGGTATCTGACATGTGACCCCTGTGAAAGGGTCATTGGACCCCCACGCACACTCATCGAGGTCACAACTCCCAGGCT
GAGAATGTTGATATTTTGATCCCTACGGCTAGGATCACTTCATCCCTTCTGTTACCTGCCATGTTCCCCACTACTGGGGA
ACAACCCCCAGTCNCAGACCCCCATCATGTCCCGGTCTGCTCTCTGTACTGAACTTGANGAGGGGAGGCTCAATTTGAAT
GCNAAACCCTACACACAGNNACNGGAGCNCTGAGAGAACCGGCTGAAGGANCTGGCTCACACCTTGCACAGCTCCCANCT
TCCTCCNGANNNCCNGGCCCTGGNNNCNGGAAATGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55002720..55003237 478
 
EST/CDNA Est Name
  BF785191.1 - BF783418.1 - CA495181.1 - CA467853.1 - AA030193.1 - AI322540.1 - BG965612.1 - AI789455.1 - BI103793.1 - BF783880.1 - BF789657.1 - BF234789.1 - BG973580.1 - CK020713.1


Sequence tag IST14132B10HMF1
Sequence
CCAGGAGAATGCGGAGCAGCGGTTCTCAACCTTCCTAATGCTGAGACCCTTTAATGCAGTTCCTCATGCCACAGTGACCC
TCCCCAAACAAAAAATTTTGTTGCTACTTCACCATTTTAATTCTACTACTGTTATGAATCATAATGTAAATATATGTTAT
GTAGGGTATCTGACATGTGACCCCTGTGAAAGGGTCATTGGACCCCCACNCACACTCATCGAGGTCACAACTCCCANGCT
GANAATGTTGATATTTTGATCCCTACGGCTAGGATCACTTCATCCCTTCTGTTACCTGCCNTGTTCCCCACTACTGGGGA
ACAACCCCCAGTCNCAGACCCCCATCATGTCCCGGTCTGCTCTCTGTACTGAACTTGANGAGGGGAGGCTCAATTTGAAT
GCNAAACCCTACACNCNGANACNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55002720..55003144 403
 
EST/CDNA Est Name
  CA495181.1 - CA467853.1 - AA030193.1 - AI322540.1 - AI789455.1 - BF789657.1 - CK020713.1


Sequence tag IST14132B10HMR1
Sequence
GGCCGGGGTCGCTGTAAGAAAAGGCGTGAGTCAGCTGTCTTGTCTGTGCTCATGACCGTGAACAGAACCAAGACAAAGTG
CCCTGTGACATGGAGCTGCAGACTCTGCGAAGCAGAAGTANTCCTTTAAGTCTATTCCAGTCCCATGCTGTGACCTATGG
TTACCCTGCTANGCTGGCCCACCCTGGGGCATCGTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55002522..55002721 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es