Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14701E3
Clone ID IST14701E3
Vector VICTR76
Project tigm

Sequence tag IST14701E3HMR1
Sequence
GNAAACAAANACCCTTTCNGGATGTACGTTCGGCATCTCCAATGCCNTTCAGGCCACTTACTCAATAAAGCACAACACCA
CTTCTAGACCAGGCGAGCAGACAAAACACTGTTTCAAGTGAGAATTTTAAAGGTCTTTATGAATAATCATAGTAATACTT
AATATTTTAGCCAGGCAGTGCTGGCACACTCCTTTAACCCCAGCACTTGGGAGGCAGAGACAGGTGGATCTCTGTGAGTT
CAAGGCCNNCCTGGTCTACNNANCANGTTCTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108353916..108354196 263
 
EST/CDNA Est Name
  AI874809.1 - BY297238.1 - AL363424.1 - BY062612.1 - BY089016.1 - BY170961.1 - BY066487.1 - BY043920.1 - BY294048.1 - BF722029.1 - BY318218.1 - BY767954.1 - BY131147.1 - BY006163.1


Sequence tag IST14701E3HMF1
Sequence
CTAAGACCCATGTTGTCTGGGCTTCTTGACAATGCACTTTGTTCTAGAGCTGCCATATAAAAGCTTGGATTATACATTGT
GCTTCTCCAAGCAAGGAGAACGCCCGTTCCAGTGCGGTGAGTGCCAGCTTGCTGCTGACTGACTGTCATGTGACCTTTGC
TTGCAGGCTCGGTTGTCCTACATGCGGGTGAAGTATCTTTTCTTTTCCTGGCTGGTGGTTTTTGNCNGANNCNGN
Sequence Type genomic DNA
Unitrap ID UNI15792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108353676..108353904 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029270 (2900024C23Rik) NM_026062 RIKEN cDNA 2900024C23 gene Gene [Source:MGI Symbol;Acc:MGI:1914516]

 
Come back to gene ENSMUSG00000029270


For any suggestions or comments, please send an email to unitrap@crg.es