Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568B10
Clone ID IST14568B10
Vector VICTR74
Project tigm

Sequence tag IST14568B10BBF2
Sequence
NGTTTANTGANAACTTGNCNNAANAAAATAANGCANANCAAGANANCACANGCCATCTCCTCTGGCCTTTATGCACTCCT
GCGTGTGTACNNACCCANACAAANACAAACCACAAATGANCTGACTTCCCCCTTTGCTAGTGTTCACACGGGGAGAGGAA
GAGCCTTGACATAGTACACTCATTCATTCCCTAATCAGCAGTCATATAAAGAACCTAACATGCACTGGACACTTTACTGA
GATGCCCAGTACAGAGAATGTGACTATTCTCTGTGTGTGTGTTCATTCATTCACGTGTGTATGTGAAGCTGCACATGTGT
ACTCAGGCAGGTGTCCTCCTCCTCAATCTCTTGTTTTTGAGAATGACCCCTCACTGAATCTGGAGCTCACCAGTTCAGAN
ACATGGGCTTGCCAGGAAGTCCCAGGGGTCTCGTGTCTGCCTGCCNGCTCTGGGATGACAGAAGCCACAGTACCAGTCTT
CTGTACNCAGATCAAGCTNNNTCCCTTTGCTTGAGCATTTTACTAAGCNNTCTCCACNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14568B10HMR1
Sequence
ANTGTAAATTAAGCCAGTAGCCAGCATACTCCAGCAGTCCTGTCTGGCTGTCACTACCATCCACAGCACTGAGGTTACAG
GCCCATGCTTGTGCCTGCCCCTGCTTGAATGTCAAATGCTCTTACCCACTGAGCTGTCTTCCCATCCCTGTGAGCCAATT
TTTGTGTTAGGCTTTGAACCGATTTGAGTTTGGGGTACACACGGGAAGGTTCCTGGGACAAGTGAAGGGGTANATCCAGA
CTGATTANATGAGGGCTTCCACAGTGTGTATGGAACANACAGGATAGTGGGGCCGGACATGTACATGACCTGTACAATGG
CNTCNNNGACGGAAGANAGTANAAAATANGTGGGGCGTGTCCTGGGACAGCCNCACTGGCTGTAACCCC
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180439487..180439872 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es