Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15111B6
Clone ID IST15111B6
Vector VICTR80
Project tigm

Sequence tag IST15111B6BBF1
Sequence
AAACAAACTTAAGTTTGAAGTTTATCCCAGGCAGAGCAGAAGCTTGGGAAGGCCTCGGGCCTTAGAGCGCTATTGACCTC
TACATAGAAGGAGACGGGCTAGGGGATGCGGGCCGTAGCTCAGTTGGTAGAGTGCTTGCCTAGCACGCACAAAGCTGGCG
TTCAATCCCTAGCCCGGCAAACAACTGGGCTGTAGACTGCCTCCTGCCAGCTCTCCATCCTAGTAGGCCCTTGAGCAAGG
CCAGGAGGTACTGGGGGGCTTAGAGAAATGGACTAAGGCCAGTCCATGGCAAGAGTCCAGGAGGGCCAGACTGACCCTCC
CATTACAGCTGANAGAAGCAGGAATAAGAGATAGAAAAGCAGGATANAGATAATTAAGGCTGTCNACAATCGGGGCNNNG
GCCTGCTGTGTGCTANTCNATGGGTGCNTGTN
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117040355..117040785 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST15111B6HMF1
Sequence
AAACAAACTTAAGTTTGAAGTTTATCCCAGGCAGAGCAGAAGCTTGGGAAGGCCTCGGGCCTTAGAGCGCTATTGACCTC
TACATAGAAGGAGACGGGCTAGGGGATGCGGGCCGTAGCTCAGTTGGTAGAGTGCTTGCCTAGCACGCACAAAGCTGGCG
TTCAATCCCTAGCCCGGCAAACAACTGGGCTGTAGACTGCCTCCTGCCAGCTCTCCATCCTAGTAGGCCCTTGAGCAAGG
CCAGGAGGTACTGGGGGGCTTAGAGAAATGGACTAAGGCCAGTCCATGGCAAGAGTCCAGGAGGGCCAGACTGACCCTCC
CATTACAGCTGAGAGAAGCAGGAATAAGAGATAGAAAAGCNNGATAGAGATAATTAAGGCTGTCNACG
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117040399..117040785 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es