Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14137G5
Clone ID IST14137G5
Vector VICTR74
Project tigm

Sequence tag IST14137G5BBF1
Sequence
NNNNNNNGGCTGANAATGCNNNNANANNCNNNCNNNTANNCCNCACCCCTACNTGGCCTCTGNNTCANCTCCTACCCANT
GATNTGGAAGTGTAANCCAAATAAACCCTTTCCTCCCCAACTGGCTTGATCATGGTGTTGTTGGTTTNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14137G5HMF2
Sequence
TATTACCATGCCAAAAAAATCTCCAGAATTTCTTTTGTATTACTTCACACATAACTCTGTAACTTTGGTACCTTCTCACT
CCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4391683..4391768 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020647 (Ncoa1) NM_010881 nuclear receptor coactivator 1 Gene [Source:MGI Symbol;Acc:MGI:1276523]


Sequence tag IST14137G5HMR1
Sequence
TTTCTTATAGAACCCAGATCCGCTATCCCAGGGATGGCAGCACTCACAACTCCATCCATAACTAATTAAGAAAATGCCCC
ACAGGCTTGTCTGGAACCCAGTCTTATGGATGTTGCCTTTTCTTCATTGAGGGTCCCTCCTCTCAGATAACTTTCGCTTG
GACCAAGATTATTCNNCACATANCCCATATCTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34931848..34932071 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es