Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11003F1
Clone ID IST11003F1
Vector VICTR76
Project tigm

Sequence tag IST11003F1BBF1
Sequence
CAGTACAAAGAGGCTGAGTGAGAGAATCACCTCCTGGCCCACGAGCAGTGACAACAGTCTGGGTAGGTGTGATCAAGTGT
CATGTGACCATGCCCCATTGTCCCTACTACATTACATCTAAGTGGTCACCCCTGTCCCCTTCCGCTCAAGGGGAATTCCC
TCCTGGTGACAGCTTCTCTCCNATGGCTTCTTGCTTCCTAGCTTATTTTTTTCCAGATCAATTCTCACATTTTCTAGCTG
TAATAATCCTTTTAAATATCTCTGGAGAACCAAGTGTGATGCAAAGGTCTGTAATCATAGCACTTGAGGGGCANANGCAN
GGAGATTGTGAGCTTGANTCCNCTCCTTTTGTGAATGTTATAATTTCCTCTGATACAAGACAAGCAATTNAGAAGCNAGT
NCTTAAGGATTTTGATAATTACTTGACNTGGGTGATAAAAATGGGATTTCTCACACNTACTNTNAGAGTATTCNACTATA
GGTGTATTTTTTTTTCNATTTTTAAAATTTCACTTTATGTGCNTTNGG

Sequence Type genomic DNA
Unitrap ID UNI31033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44918369..44918891 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]


Sequence tag IST11003F1HMF1
Sequence
CAGTACAAAGAGGCTGAGTGAGAGAATCACCTCCTGGCCCACGAGCAGTGACAACAGTCTGGGTAGGTGTGATCAAGTGT
CATGTGACCATGCCCCATTGTCCCTACTACATTACATCTAAGTGGTCACCCCTGTCCCCTTCCGCTCAAGGGGAATTCCC
TCCTGGTGACAGCTTCTCTCCNATGGCTTCTTGCTTCCTAGCTTATTTTTTTCCAGATCAATTCTCACATTTTCTAGCTG
TAATAATCCTTTTAAATATCTNTGGANAACCAAGTGTGATGCAAAGGTCTGTAATCATAGCACTTGAGGGGCANANGCAG
GGAGATTGTGAGCTTGANTCCNCTCCTTTTGTGAATGTTATAATTTCCTCTGATACAAGACAAGCAATTNAGAAGCAAGT
ACTTAAGGATTNTGATAATNACTTGACATGGGTGATAAAAATGGGATTTCTCACACATACTNTNAGAGTATTCNACTATA
GGTGTATTTTTTTTNNATTTTTAAAATTTCACTTTATGTGCNNNGGNGNNNANGGN
Sequence Type genomic DNA
Unitrap ID UNI31033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44918372..44918891 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es