Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11696A8
Clone ID IST11696A8
Vector VICTR76
Project tigm

Sequence tag IST11696A8BBF1
Sequence
CTTTTAATCCCAGCATTCCNNAGTTTCNGTAACTCNAGTTTGGGGCTAGCCTGGTCTACATAGCGAGTTCTGCACAGCTA
GGACTGACAGGACTGACTACATGGAAACCCTGTCTTAAAAAAAAAGGGTGTGTGTGTGTGCTGGAAAAATGGCTCAATGA
TTAANANCACCGACTGTTCTCTGAAGGTCCTGANTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCTATAATGA
NATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11696A8HMR1
Sequence
AAGTATACCACCCTACCCAGCCTAAGTTTTTGATACATATGATTAATAAAAATAGGCATACAATTCTAAAATAATGGAGT
TAAATTTCNGAAGAAATAGCTAAAAGTTTAAAAAGGGGGGGTTACACTTGGGACTTTTGTTTTACTTAACTTTATGTACA
AGTATTTGAAGCTAATGTCAGTGTTGGTTCAGATCAATTGTCTGCAGCATCCAAGTTTTGTTTGGTGGTANTAAGGAACA
NGNCCN
Sequence Type genomic DNA
Unitrap ID UNI25016

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94168072..94168316 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]

 
Come back to gene ENSMUSG00000020863


For any suggestions or comments, please send an email to unitrap@crg.es