Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10915A10
Clone ID IST10915A10
Vector VICTR76
Project tigm

Sequence tag IST10915A10BBF1
Sequence
ATACACTTGCACACAGTAGTAATTTAAATAAAATCCAAAGTGCCACATAGTCACAATATTTTTTAATCGAGAGATTAATA
AATAACTAATTTTGCCTGTCCTTCTCTTTAAAGGCACTGCTAATGTATAAGGCTGACTCATTAATATGAGTTATAACTCA
GGCCCAAGGAAAGATTAACAAGGGCTAGAGAGATGGCTCATCGGGTAAGAGCACTGACTGCTCTTCCAAAGGTCCTGAGT
TCAAATCCCANCANCCACATGGTGGCTCACAACCATCTGTAATGAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5605226..5605516 287
 
EST/CDNA Est Name
  BB565641.1 - AA475676.1 - DV044250.1 - W90996.1 - AA118966.1 - AA623937.1 - W54499.1 - W54371.1 - BM052553.1 - BI790714.1 - BE656353.1 - BE633615.1 - AA543858.1 - AA545070.1 - BI791289.1 - AA015286.1 - AI664194.1 - CJ165657.1 - AA796677.1 - AA051268.1 - W


Sequence tag IST10915A10HMR1
Sequence
ATGTGCATGTGTGCATGGTACATCTGTGGGGGTCAGAAGAGGGCGACTTTCTGAGGCAGTTGTCTCCACACCACCTTGTT
GAGACAAGGCCTCTCTCTTTCTCGTGTCTGCTGTGGTTTGGACTCCAGGCATCTCTTGAACTTCCTGGGCAGTTCTCCGT
CATCTCGTTGTAAGAGTGCTAGGCTGACTGGTGTGTGCCACTGCTTCTGGCTTTTGTGTGAGGANCTGTGGACTGANGGT
TTAATGANATGACTCANAGGCAGCTACCACCGGGGAAGTNNNTCTGGCTTCTAACGTGTACTN
Sequence Type genomic DNA
Unitrap ID UNI13766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5604926..5605227 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020477 (Mrps24) NM_026080 mitochondrial ribosomal protein S24 Gene [Source:MGI (curated);Acc:Mrps24-001]

 
Come back to gene ENSMUSG00000020477


For any suggestions or comments, please send an email to unitrap@crg.es