Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13217G1
Clone ID IST13217G1
Vector VICTR74
Project tigm

Sequence tag IST13217G1HMR1
Sequence
NNATNNTNNCGGGGATGGGAATCTCTGGGTTGAGAAAAGTGTTGCTGTGTCTGGTCTGTCTCATCTTCTGCAGGTCCCTT
CTATCTCACCAGAGGCATGCTCAGAATATTTGACTTGGCAAGAGTCTGTCCTTCATCCTTGTCACTTAGCCCTAATAATG
GTGTCTTCTATTCTCCTCACAGGGATGAAGCTGAAATGGAGTATTTGAAGATAGCTCAGGACCTGGAGATGTATGGTGTG
AACTACTTTACAATCCGGGTGCGTTGACTCCTTCCCCAGTTCCCTGGCTCTCAGAAAGACTGAGTCGAGGCCACACAGGC
AGATGGGTCACTTCCTCATCCCAGGGTGCTTAGAGTCTTTATGGTTCAGTAGTAAAGAAGAAACGGGAAGACAAGGTCGA
GAGCCTGGTTTCATTTGGGGCTTCGAATTAGATCAGAAATAGATCAAATTAAGTGTCATTGGTACCCTGAGGGACTCNNN
CCCGGTTCTCTTCTTANCAGANNCCTGTTGGAATGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4703418..4703929 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es