Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15061E3
Clone ID IST15061E3
Vector VICTR80
Project tigm

Sequence tag IST15061E3BBF1
Sequence
TTTGGGGGCTCNNCCGGGNTCGGGANACCCCTGCCCANGGACCNNCGACCCNCCNCCGGNAGGTAANCTGGCCAGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15061E3HMR1
Sequence
GGGTGCGTGGGACCCTTCCCGGANCCCTGGCTGTCACTTCTAATCCTGTTGTCTTCTCCTTTCATCCTTCCCTCATCCAC
ACGACCCCTGGTGACACCATCTCATTGAACATCCTGCTCTTAGGCCTGCTCTCCTCAGGGTTCTACAGAGCCTGCAGTGC
CAGGCATCAGCTGTGCACCTCTGGCTTTCTTTGGTAATCCAGCATTGATCTTAGAGCCTACTGGGTCTGAGCTGGTGTGG
GACCAGCCTCTTTCTCCGGCTCTGGAGAACTGGAACAGGTAGGATANAGTTGGGCTAGCACTCTAGGCTGTATTCAAAAC
CATGTACCCCTACCCACACCANATGANGTTTCTCTGGAGACCCCTCTCTGACATACCTGAAGAANTTCCCANCCCGCCTT
ACCCAGCANNCACTCTCTACTGGGTTACNNCAN
Sequence Type genomic DNA
Unitrap ID UNI36451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115153283..115153711 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044788 (Fads6) NM_178035 fatty acid desaturase domain family, member 6 Gene [Source:MGI (curated);Acc:Fads6-001]


Sequence tag IST15061E3HMF2
Sequence
CTCTGAGGTTCCTTTGTGCCAGGTAACCCAATACGAACACCTGCACCGCCCTGCCAGGCCCTGCAGCCTCTCAGGTAACA
AGCACAAAATAAACAAACACTGTGGGAAGCAGCCCTGTGCTGCCTCTGTGACAGGCAGTGTGTCGTCCCAGGAAGAAACA
CAAGGCCACACTATGGCTCATGGGAGGCCTGGCAAGTCTGTACCGTCTCATCCAGTGCCCTCAAAGGGTTAACGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115153711..115153944 234
 
EST/CDNA Est Name
  BY128678.1

 
Come back to gene BY128678.1


For any suggestions or comments, please send an email to unitrap@crg.es